VGAsoft logo

VGAsoft | Разработка программного обеспечения

HomeContact us


English ⇔ Russian
 
LMBomber
Dictionary
Speech
Download
Forum

Перевод слова


Перевод: cycle speek cycle


[прилагательное]
велосипедный;
[существительное]
цикл ; полный круг; круг ; менструация ; шаг цикла; такт процессора ; круговой процесс; круговорот ; кругооборот ; велосипед ;
[глагол]
совершать цикл развития; делать обороты; ездить на велосипеде


Тезаурус:

  1. These phenomena are associated with key points in the yearly, monthly and daily cycle, such as Midsummer, full moon and midnight.
  2. We make use of two cycle length records, that presented by Friis-Christensen and Lassen, FCL, and our own estimate, KW (Fig. 1).
  3. The particular focus which I find valuable is the concept of the "life course", which is different from the more orthodox conception of the "life cycle" and "family life cycle", in that it allows for more variation and does not assume that family relationships go through a series of modifications which are totally predictable in advance.
  4. An essay in the latest issue of the Microprocessor Report makes the point that the designers that are pressing the clock speed argument such as MIPS, Hewlett-Packard Co and DEC are the ones winning the performance race, not those such as Sun, IBM and Motorola Inc that stress instructions per cycle.
  5. Briefly, the reverse strand primer TTCCTTCATCTAAATCATCT (0.5pmol) was labelled with 35 S ATP and the supplied TTP cycle mix and reaction buffer for 80PCR cycles with annealing at 55C for 45s, and subsequent termination reactions done for 50 cycles with annealing at 60C for 45s.
  6. That is, a function of the duty cycle of the switching waveform, or:
  7. He had previously pedalled his way to make the first cycle crossings of the High Atlas mountains in Morocco, and of Lapland from the Arctic Ocean to the Baltic Sea.
  8. On a time-scale which may not coincide exactly with our present scientific calculations of geological time, they say that the cycle commences with a period of 1.7 million years when the power of the Life Force is immeasurably stronger and more evident in physical affairs than it is today.
  9. From AD 312 "indiction cycles" of fifteen years' duration were introduced by the Emperor Constantine for taxation purposes and led to the Byzantine year being reckoned from 1 September, the date on which each year of an indiction cycle began.
  10. The museum has treated this material in thematic fashion, reserving a concluding gallery for "The Green Room" series of paintings (1907), that bitter cycle of love and jealousy which was intended to evoke the mood of a brothel in Berlin.
  11. Former RAF engineer David Adams, 42, died when he was knocked off his cycle on his way home from a shopping trip.
  12. A parallel and significant trend of policy is a move in a number of countries to differentiate between a basic education cycle and a continuation cycle, the first aiming to provide basic learning skills, the latter emphasising prevocational studies and education for citizenship.
  13. "Means a two wheeled motor cycle, whether having a sidecar attached thereto or not, and for the purposes of this definition any wheels of a motor cycle shall, if the distance between the centres of the areas of contact between such wheels and the road surface is less than 460 millimetres, be counted as one wheel; per regulation 4 (3) Motor Cycles (Protective Helmets) Regulations 1980.

MAGIA Site Design

    Copyright © 1986-2025 VGAsoft. All rights reserved.

About USPrivacy